Journal: Cell systems

Article Title: Loss of TET2 affects proliferation and drug sensitivity through altered dynamics of cell-state transitions

doi: 10.1016/j.cels.2020.06.003

Figure Lengend Snippet: KEY RESOURCES TABLE

Article Snippet: ​ REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies PE Mouse anti-Human CD34 BD Biosciences 555822 PE-Cy5 Mouse anti-Human CD38 BD Biosciences 555461 Chemicals, Peptides, and Recombinant Proteins Cytosine Beta-D-Arabinofuranoside Sigma-Aldrich C6645 Disulfiram Sigma-Aldrich D2950000 Human IFN-g PeproTech 300-02 Critical Commercial Assays CellTiter-Glo 2.0 Cell Viability Assay Promega G9242 QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina Lexogen 0.15.24/96 MethoCult H4034 Optimum STEMCELL #04034 Deposited Data Raw and analyzed data This paper; Mendeley data doi: 10.17632/xmvz47rpg6.1 Epigenome analysis of leukemia stem, blast and normal hematopoietic stem/progenitor cells Jung et al., 2015 ; GEO {"type":"entrez-geo","attrs":{"text":"GSE63409","term_id":"63409"}} GSE63409 Experimental Models: Cell Lines Human male: KG-1 ATCC CCL-246; RRID: CVCL_0374 Human male: THP-1 ATCC TIB-202; RRID: CVCL_0006 Oligonucleotides Primer HOXA5-F: TCTCGTTGCCCTAATTCATCTTTT McLaughlin-Drubin et al., 2011 N/A Primer HOXA5-R: CATTCAGGACAAAGAGATGAACAGA McLaughlin-Drubin et al., 2011 N/A Primer CD38-F: CACCAAGCGCTTTCCCGAGACC This paper N/A Primer CD38-R: GAGAGGCCCCTCCAGTGCAGAA This paper N/A Primer CORO1A-F: GTGGTCCGCTCCAGCAAGTTCC This paper N/A Primer CORO1A-R: CAGACCGTGGGCGCATTCTTGT This paper N/A Primer ITGAM-F: CTCCGTGGACGTGGACAGCAAC This paper N/A Primer ITGAM-R: AATGGCCACGTCCGTCAGCTTG This paper N/A Primer TAL1-F: GGGAGCCGGATGCCTTCCCTAT This paper N/A Primer TAL1-R: ACTTCATGGCCAGGCGGAGGAT This paper N/A Recombinant DNA pSpCas9(BB)-2A-Puro (PX459) V2.0 Addgene #62988 Software and Algorithms Code to generate all figures This paper; Mendeley data doi: 10.17632/xmvz47rpg6.1 Code pertaining to model This paper; GitHub https://github.com/AltschulerWu-Lab/tet2-dynamics DNA methylation age calculator Horvath, 2013 https://horvath.genetics.ucla.edu/html/dnamage/ R R Core Team, 2019 https://www.R-project.org MATLAB R2019a https://www.mathworks.com Open in a separate window KEY RESOURCES TABLE TET2 knockout in human AML cell lines increases stem-like signatures TET2 KO cells have altered dynamics between stem-like/differentiated states Altered cell-state switching dynamics provides fitness advantage in and out of drug

Techniques: Recombinant, Viability Assay, Software, DNA Methylation Assay

Journal: Molecular omics

Article Title: Pan-transcriptomic analysis identified common differentially expressed genes of Acinetobacter baumannii in response to polymyxin treatments

doi: 10.1039/d0mo00015a

Figure Lengend Snippet: GEO RNA-Seq data of A. baumannii isolates treated with polymyxins

Article Snippet: 29 table ft1 table-wrap mode="anchored" t5 Table 1. caption a7 Accession Strain Treatment Replicate Reference {"type":"entrez-geo","attrs":{"text":"GSE56218","term_id":"56218","extlink":"1"}} GSE56218 34654 Polymyxin B (0.75×MIC * ) / control 15 min 2:2 -- ** {"type":"entrez-geo","attrs":{"text":"GSE56219","term_id":"56219","extlink":"1"}} GSE56219 478810 Polymyxin B (0.75×MIC * ) / control 15 min 2:2 -- {"type":"entrez-geo","attrs":{"text":"GSE56220","term_id":"56220","extlink":"1"}} GSE56220 983759 Polymyxin B (0.75×MIC * ) / control 15 min 2:2 -- {"type":"entrez-geo","attrs":{"text":"GSE56221","term_id":"56221","extlink":"1"}} GSE56221 1000160 Polymyxin B (0.75×MIC * ) / control 15 min 2:2 -- {"type":"entrez-geo","attrs":{"text":"GSE56222","term_id":"56222","extlink":"1"}} GSE56222 1207552 Polymyxin B (0.75×MIC * ) / control 15 min 2:2 -- {"type":"entrez-geo","attrs":{"text":"GSE56223","term_id":"56223","extlink":"1"}} GSE56223 1428368 Polymyxin B (0.75×MIC * ) / control 15 min 2:2 -- {"type":"entrez-geo","attrs":{"text":"GSE56224","term_id":"56224","extlink":"1"}} GSE56224 1457504 Polymyxin B (0.75×MIC * ) / control 15 min 2:2 -- {"type":"entrez-geo","attrs":{"text":"GSE56225","term_id":"56225","extlink":"1"}} GSE56225 1564232 Polymyxin B (0.75×MIC * ) / control 15 min 2:2 -- {"type":"entrez-geo","attrs":{"text":"GSE56226","term_id":"56226","extlink":"1"}} GSE56226 1592897 Polymyxin B (0.75×MIC * ) / control 15 min 2:2 -- {"type":"entrez-geo","attrs":{"text":"GSE62794","term_id":"62794","extlink":"1"}} GSE62794 ATCC 19606 Colistin (0.2 mg/L 60 min) / colistin (2 mg/L 15 min) / colistin (2 mg/L 60 min) / control (15 min) / control (60 min) 2:2:2:2:2:2 17 Open in a separate window * MIC was not clarified in the original datasets.

Techniques:

Journal: Molecular omics

Article Title: Pan-transcriptomic analysis identified common differentially expressed genes of Acinetobacter baumannii in response to polymyxin treatments

doi: 10.1039/d0mo00015a

Figure Lengend Snippet: GEO RNA-Seq data of A. baumannii isolates treated with polymyxins

Article Snippet: Strain ATCC 19606 was classified as ST52 but not assigned an international clone lineage. table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Accession Strain Verification (16s rRNA BLAST) a Verification (MLST) Used in this study {"type":"entrez-geo","attrs":{"text":"GSE56218","term_id":"56218","extlink":"1"}} GSE56218 34654 A. baumannii A. baumannii Yes {"type":"entrez-geo","attrs":{"text":"GSE56219","term_id":"56219","extlink":"1"}} GSE56219 478810 Acinetobacter sp . strain HS2YWS12 A. pittii No {"type":"entrez-geo","attrs":{"text":"GSE56220","term_id":"56220","extlink":"1"}} GSE56220 983759 A. radioresistens strain a2 No {"type":"entrez-geo","attrs":{"text":"GSE56221","term_id":"56221","extlink":"1"}} GSE56221 1000160 A. baumannii No {"type":"entrez-geo","attrs":{"text":"GSE56222","term_id":"56222","extlink":"1"}} GSE56222 1207552 A. baumannii A. baumannii Yes {"type":"entrez-geo","attrs":{"text":"GSE56223","term_id":"56223","extlink":"1"}} GSE56223 1428368 A. baumannii A. baumannii Yes {"type":"entrez-geo","attrs":{"text":"GSE56224","term_id":"56224","extlink":"1"}} GSE56224 1457504 A. baumannii A. baumannii Yes {"type":"entrez-geo","attrs":{"text":"GSE56225","term_id":"56225","extlink":"1"}} GSE56225 1564232 A. pittii No {"type":"entrez-geo","attrs":{"text":"GSE56226","term_id":"56226","extlink":"1"}} GSE56226 1592897 A. nosocomialis A. nosocomialis No Open in a separate window a BLASTn, identity ≥95%, coverage ≥95%, E-value ≤1×10 −10 .

Techniques:

Journal: Molecular omics

Article Title: Pan-transcriptomic analysis identified common differentially expressed genes of Acinetobacter baumannii in response to polymyxin treatments

doi: 10.1039/d0mo00015a

Figure Lengend Snippet: Species identification for 9 strains by 16S rRNA BLAST and MLST

Article Snippet: Strain ATCC 19606 was classified as ST52 but not assigned an international clone lineage. table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Accession Strain Verification (16s rRNA BLAST) a Verification (MLST) Used in this study {"type":"entrez-geo","attrs":{"text":"GSE56218","term_id":"56218","extlink":"1"}} GSE56218 34654 A. baumannii A. baumannii Yes {"type":"entrez-geo","attrs":{"text":"GSE56219","term_id":"56219","extlink":"1"}} GSE56219 478810 Acinetobacter sp . strain HS2YWS12 A. pittii No {"type":"entrez-geo","attrs":{"text":"GSE56220","term_id":"56220","extlink":"1"}} GSE56220 983759 A. radioresistens strain a2 No {"type":"entrez-geo","attrs":{"text":"GSE56221","term_id":"56221","extlink":"1"}} GSE56221 1000160 A. baumannii No {"type":"entrez-geo","attrs":{"text":"GSE56222","term_id":"56222","extlink":"1"}} GSE56222 1207552 A. baumannii A. baumannii Yes {"type":"entrez-geo","attrs":{"text":"GSE56223","term_id":"56223","extlink":"1"}} GSE56223 1428368 A. baumannii A. baumannii Yes {"type":"entrez-geo","attrs":{"text":"GSE56224","term_id":"56224","extlink":"1"}} GSE56224 1457504 A. baumannii A. baumannii Yes {"type":"entrez-geo","attrs":{"text":"GSE56225","term_id":"56225","extlink":"1"}} GSE56225 1564232 A. pittii No {"type":"entrez-geo","attrs":{"text":"GSE56226","term_id":"56226","extlink":"1"}} GSE56226 1592897 A. nosocomialis A. nosocomialis No Open in a separate window a BLASTn, identity ≥95%, coverage ≥95%, E-value ≤1×10 −10 .

Techniques:

Journal: Endocrinology

Article Title: Leukemia Inhibitory Factor Is Necessary for Ovulation in Female Rhesus Macaques

doi: 10.1210/en.2016-1283

Figure Lengend Snippet: LIF mRNA and protein levels (mean ± SEM) in the rhesus macaque follicle increase after administration of an ovulatory bolus of hCG. A, LIF mRNA levels in rhesus macaque follicles removed before (0 h) or 12, 24, and 36 hours after the administration of an ovulatory bolus of hCG were determined from a Affymetrix DNA array database (NCBI GEO GSE2277; Ref. 6) and qPCR (n = 4–6/time point). The 36-hour post-hCG time point includes follicles that were unruptured (36-h UNR) and those that had ruptured (36-h R). B, LIF protein levels were assessed in follicular fluid collected before (0 h), as well as 12 and 24 hours after hCG administration (n = 3–4/group). Columns with different letters are significantly different (P < .05).

Article Snippet: A, LIF mRNA levels in rhesus macaque follicles removed before (0 h) or 12, 24, and 36 hours after the administration of an ovulatory bolus of hCG were determined from a Affymetrix DNA array database (NCBI GEO {"type":"entrez-geo","attrs":{"text":"GSE2277","term_id":"2277"}} GSE2277 ; Ref. 6 ) and qPCR (n = 4–6/time point).

Techniques: DNA Array

Journal: Addiction biology

Article Title: Significant, replicable and functional associations between KTN1 variants and alcohol and drug co-dependence

doi: 10.1111/adb.12888

Figure Lengend Snippet: Molecular effects of alcohol or drug exposure on the KTN1 mRNA expression in six independent cohorts

Article Snippet: Alcohol, nicotine and cocaine significantly affected the KTN1 mRNA expression, and the KTN1 mRNA was differentially expressed between nicotine or cocaine dependent and control subjects ( ) table ft1 table-wrap mode="anchored" t5 Table 2. caption a7 Cohort 1 Cohort 2 Cohort 3 Cohort 4 Cohort 5 Cohort 6 Organism Human Human C57BL/6J mice C57BL/6J mice Human Human Dataset names GEO GEO GEO GEO GEO GEO Accession number {"type":"entrez-geo","attrs":{"text":"GSE56906","term_id":"56906"}} GSE56906 {"type":"entrez-geo","attrs":{"text":"GSE20489","term_id":"20489"}} GSE20489 {"type":"entrez-geo","attrs":{"text":"GSE15774","term_id":"15774"}} GSE15774 {"type":"entrez-geo","attrs":{"text":"GSE15774","term_id":"15774"}} GSE15774 {"type":"entrez-geo","attrs":{"text":"GSE6264","term_id":"6264"}} GSE6264 {"type":"entrez-geo","attrs":{"text":"GSE54839","term_id":"54839"}} GSE54839 References Kim et al., 2016 Kupfer et al. 2013 Korostynski et al. 2013 ; Piechota et al. 2010 Piechota et al. 2010 ; Korostynski et al. 2013 Philibert et al. 2007 Bannon et al. 2014 Experiment methods Affymetrix Human Genome U133A Array Affymetrix Human Genome U133A Array Illumina MouseWG-6 Microarray Illumina MouseWG-6 Microarray ABI 1700 Human Genome Expression Microarray Illumina HT-12 Microarray Measurement of expression Log2(normalized intensity) Log2(normalized intensity) Log2(normalized intensity) Log2(normalized intensity) Log2(normalized intensity) Log2(normalized intensity) Control subjects: Treatment/Phenotype without EtOH without EtOH Saline (1h) Saline (4h) No tobaco abuse No cocaine abuse Tissue types NPCs from differentiated H1 hESC Blood Striatum Striatum Lymphoblast cell Midbrain Sample sizes 2 5 3 3 9 10 Expression levels 12.8±0.01 9.3±1.5 6.53±0.05 6.44±0.01 6.6±0.5 10.6±0.5 Case subjects: Treatment/Phenotype with 20mM EtOH alcohol depletion to <0.02% wt/vol Nicotine (1 mg/kg) (1h after injection) Cocaine (25 mg/kg) (4h after injection) Nicotine dependence Cocaine dependence Tissue types NPCs from differentiated H1 hESC Blood Striatum Striatum Lymphoblast cell Midbrain Sample sizes 2 6 3 3 6 10 Expression levels 12.7±0.02 6.4±0.5 6.29±0.13 6.74±0.16 7.2±0.4 10.8±0.4 p-values for t-test 0.015 0.001 0.040 0.034 0.034 0.088 Open in a separate window GEO, Gene Expression Omnibus database;EtOH, ethanol; NPC, Neural progenitor cells; hESC, human embryonic stem cells.

Techniques: Expressing, Microarray, Injection